Please note these are NOT comprehensive lists of primers; rather these are primers that may be useful for those working with fungi of the Ascomycota, or algae of the Chlorophyta UTC clade.
Fungal Mitochondrial Small Subunit:
| Primer | F/R | Position | Sequence | Reference |
| MSU1 | F | 116-135 | GATGATGGCTCTGATTGAAC | Zhou & Stanosz (2001) |
| mtSSU1-KL | F | 305-323 | AGTGGTGTACAGGTGAGTA | Lohtander et al. (2002) |
| MS1 | F | 532-556 | CAGCAGTCAAGAATATTAGTCAATG | White et al. (1990) |
| mrSSU1 | F | 533-552 | AGCAGTGAGGAATATTGGTC | Zoller et al. (1999) |
| mrSSU-1/2-5’-mpn | F | 682-703 | GTGCCAGCAGTCGCGGYAANAC | Nelsen et al. (2011) |
| mrSSU2 | F | 885-904 | CTGACGTTGAAGGACGAAGG | Zoller et al. (1999) |
| mrSSU2R | R | 885-904 | CCTTCGTCCTTCAACGTCAG | Zoller et al. (1999) |
| mrSSU-2/3-3’-mpn | R | 1027-1053 | GGTGRARTGCTTNCACTTTCATTTATA | Nelsen et al. (2011) |
| MS2 | R | 1121-1142 | GCGGATTATCGAATTAAATAAC | White et al. (1990) |
| mtSSU2-KL | R | 1504-1524 | ATGTGGCACGTCTATAGCCCA | Lohtander et al. (2002) |
| mrSSU3R | R | 1504-1524 | ATGTGGCACGTCTATAGCCC | Zoller et al. (1999) |
| MSU7 | R | 1594-1615 | GTCGAGTTACAGACTACAATCC | Zhou & Stanosz (2001) |
Lohtander, K., I. Oksanen & J. Rikkinen. 2002. A phylogenetic study of Nephroma (lichen-forming Ascomycota). Mycological Research 106: 777-787.
Nelsen, M.P., Lücking, R., Mbatchou, J.S., Andrew, C.J., Spielmann, A.A. & H.T. Lumbsch. 2011. New insights into relationships of lichen-forming Dothideomycetes. Fungal Diversity 51: 155-162.
White, T.J., T. Bruns, S. Lee & J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 in PCR Protocols: A Guide to Methods and Applications (Innis, N., D. Gelfand, J. Sninsky & T. White, Eds.), Academic Press.
Zhou, S. & G.R. Stanosz. 2001. Primers for amplification of mt SSU rDNA, and a phylogenetic study of Botryosphaeria and associated anamorphic fungi. Mycological Research 105: 1033-1044.
Zoller, S., C. Scheidegger & C. Sperisen. 1999. PCR primers for the amplification of mitochondrial small subunit ribosomal DNA of lichen-forming ascomycetes. Lichenologist 31: 511-516.
Fungal Internal Transcribed Spacer (ITS):
| Primer | F/R | Locus | Position | Sequence | Reference |
| *ITS1F | F | 18S | 1731-1752 | CTTGGTCATTTAGAGGAAGTAA | Gardes & Bruns (1993) |
| ITS5 | F | 18S | 1745-1766 | GGAAGTAAAAGTCGTAACAAGG | White et al. (1990) |
| ITS1 | F | 18S | 1769-1787 | TCCGTAGGTGAACCTGCGG | White et al. (1990) |
| ITS3 | F | 5.8S | 31-50 | GCATCGATGAAGAACGCAGC | White et al. (1990) |
| ITS2 | R | 5.8S | 31-50 | GCTGCGTTCTTCATCGATGC | White et al. (1990) |
| *ITS2-KL | R | 28S | 25-44 | TGCTTAAGTTCAGCGGGTA | Lohtander et al. (1998) |
| ITS4 | R | 28S | 41-60 | TCCTCCGCTTATTGATATGC | White et al. (1990) |
| LR1 | R | 28S | 57-73 | GGTTGGTTTCTTTTCCT | Vilgalys & Hester (1990) |
| *ITS4A (Larena) | R | 28S | 71-93 | CGCCGTTACTGGGGCAATCCCTG | Larena et al. (1999) |
| *ITS4A (Taylor) | R | 28S | 96-116 | ATTTGAGCTGTTGCCGCTTCA | D.L. Taylor in Kroken & Taylor (2001) |
| *nu-LSU-136-3’ | R | 28S | 136-154 | CAAATTACAACTCGGACCC | Döring et al. (2000) |
Many of these primers have been used in combination with each other
to amplify the fungal ITS directly from lichen thalli.
SSU positions relative to Saccharomyces cerevisiae J01353
5.8S positions relative to Saccharomyces cerevisiae D89886
LSU positions relative to Saccharomyces cerevisiae J01355
Döring, H., P. Clerc, M. Grube & M. Wedin. 2000. Mycobiont-specific PCR primers for the amplification of nuclear ITS and LSU rDNA from lichenized ascomycetes. Lichenologist 32: 200-204.
Gardes, M. & T.D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes – application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
Kroken, S. & J.W. Taylor. 2001. A gene genealogical approach to recognize phylogenetic species boundaries in the lichenized fungus Letharia. Mycologia 93: 38-53.
Larena, I., O. Salazar, V. González, M.C. Julián & V. Rubio. 1999. Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for ascomycetes. Journal of Biotechnology 75: 187-194.
Lohtander, K., L. Myllys, R. Sundin, M. Källersjö & A. Tehler. 1998. The species pair concept in the lichen Dendrographa leucophaea (Arthoniales): analyses based on ITS sequences. Bryologist 101: 404-411.
Vilgalys, R. & M. Hester. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
White, T.J., T. Bruns, S. Lee & J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 in PCR Protocols: A Guide to Methods and Applications (Innis, N., D. Gelfand, J. Sninsky & T. White, Eds.), Academic Press.
Fungal Nuclear Large Subunit:
| Primer | F/R | Position | Sequence | Reference |
| LR0R (Rehner) | F | 24-42 | GTACCCGCTGAACTTAAGC | Rehner & Samuels (1994) |
| LR0R | F | 26-42 | ACCCGCTGAACTTAAGC | Vilgalys Website? or Cubeta et al. (1991)? |
| LR1 | R | 57-73 | GGTTGGTTTCTTTTCCT | Vilgalys & Hester (1990) |
| AL2R | F | 91-112 | GCGAGTGAAGCGGCAACAGCTC | Mangold et al. (2008) |
| ITS4A-5′ | F | 96-116 | TGAAGCGGCAACAGCTCAAAT | Nelsen et al. (2011)/D.L. Taylor in Kroken & Taylor (2001) |
| nu-LSU-155-5′ | F | 136-155 | GGGTCCGAGTTGTAATTTGT | Döring et al. (2000) |
| nu-LSU-136-3′ | R | 136-154 | CAAATTACAACTCGGACCC | Döring et al. (2000) |
| nu-LSU-287-5′-mpn | F | 270-287 | CGAGTTGTTTGGGAATGC | Nelsen et al. (2011) |
| nu-LSU-362-5′ | F | 344-362 | GCGCACAAGTAGAGTGATC | Döring et al. (2000) |
| nu-LSU-355-3′ | R | 355-376 | GCTTTTCATCTTTCGATCACTC | Döring et al. (2000) |
| nu-LSU-401-3′ | R | 401-419 | CCTTTCAACAATTTCACGT | Döring et al. (2000) |
| LR3 (VilWeb) | R | 635-651 | CCGTGTTTCAAGACGGG | Vilgalys Website |
| LR3 | R | 638-654 | GGTCCGTGTTTCAAGAC | Vilgalys & Hester (1990) |
| LR3R | F | 638-654 | GTCTTGAAACACGGACC | Vilgalys Website? |
| LR4 | R | 838-854 | ACCAGAGTTTCCTCTGG | Vilgalys Website? |
| nu-LSU-871-5′ | F | 854-871 | TGGAGGCTCGCAGCGGTT | Döring et al. (2000) |
| nu-LSU-896-5′ | F | 878-896 | TGCAAATCGATCGTCAAAT | Döring et al. (2000) |
| LR5 | R | 949-965 | ATCCTGAGGGAAACTTC | Vilgalys & Hester (1990) |
| LR6 | R | 1125-1141 | CGCCAGTTCTGCTTACC | Vilgalys & Hester (1990) |
| LR7 | R | 1432-1448 | TACTACCACCAAGATCT | Vilgalys & Hester (1990) |
| LR7-R | F | 1432-1448 | AGATCTTGGTGGTAGTA | Vilgalys & Hester (1990) |
| LR12 | R | 3106-3122 | GACTTAGAGGCGTTCAG | Vilgalys & Hester (1990) |
Cubeta, M.A., E. Echandi, T. Abernethy & R. Vilgalys. 1991. Characterization of anastomosis groups of binucleate Rhizoctonia species using restriction analysis of an amplified ribosomal RNA gene. Phytopathology 81: 1395-400.
Döring, H., P. Clerc, M. Grube & M. Wedin. 2000. Mycobiont-specific PCR primers for the amplification of nuclear ITS and LSU rDNA from lichenized ascomycetes. Lichenologist 32: 200-204.
Kroken, S. & J.W. Taylor. 2001. A gene genealogical approach to recognize phylogenetic species boundaries in the lichenized fungus Letharia. Mycologia 93: 38-53.
Mangold, A., M.P. Martín, R. Lücking & H.T. Lumbsch. 2008. Molecular phylogeny suggests synonymy of Thelotremataceae within Graphidaceae (Ascomycota: Ostropales). Taxon 57: 476-486.
Nelsen, M.P., Lücking, R., Mbatchou, J.S., Andrew, C.J., Spielmann, A.A. & H.T. Lumbsch. 2011. New insights into relationships of lichen-forming Dothideomycetes. Fungal Diversity 51: 155-162.
Rehner, S.A. & G.J. Samuels. 1994. Taxonomy and phylogeny of Gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycological Research 98: 625-634.
Vilgalys, R. & M. Hester. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
Vilgalys Website: http://sites.biology.duke.edu/fungi/mycolab/primers.htm
Algal Ribulose 1,5-Bisphosphate Carboxylase Large Subunit (rbcL):
| Primer | F/R | Position | Sequence | Reference |
| rbcL1 | F | 1-20 | ATGGTTCCACAAACAGAAAC | Nozaki et al. (1995) |
| RH1 | F | 1-26 | ATGTCACCACAAACAGAAACTAAAGC | Manhart (1994) |
| rbcL B | F | 1-27 | ATGTCACCACAAACAGAAACTAAAGCA | Woolcott in Zechman (2003) |
| rbcL 7F | F | 7-26 | CCAMAAACWGAAACWAAAGC | Verbruggen et al. (2009) |
| FT122 | F | 149-168 | CAGAAGAAGCAGGAGCAGCA | Rindi et al. (2009) |
| FT147 | F | 174-193 | GGCAGAATCATCAACAGGAA | Rindi et al. (2009) |
| a-ch-rbcL-203-5’-MPN | F | 178-203 | GAATCWTCWACWGGWACTTGGACWAC | Nelsen et al. (2011) |
| rbcL320 | F | 320-341 | TATTCGAAGAAGGTTCAGTAAC | Nozaki et al. (1995) |
| rbcL395 | R | 376-395 | GCACGTAAAGCTTTGAAACC | Nozaki et al. (1995) |
| rbcL 7 | F | 391-409 | CGTGCTCTTCGTTTAGAAG | Zechman (2003) |
| rbcL 7R | R | 391-409 | CTTCTAAACGAAGAGCACG | Zechman (2003) |
| rbcL 436F | F | 436-455 | AAAACWTTYCAAGGICCICC | Verbruggen et al. (2009) |
| a-ch-rbcL-494-5’-MPN | F | 475-494 | CGTGAYAAAHTDAACAAATA | Nelsen et al. (2011) |
| rbcL 530R | R | 511-530 | TTWGGTTTAATWGTACARCC | Verbruggen et al. (2009) |
| rbcL650 | F | 650-671 | GTTTCCTTTTCGTAGCTGAAGC | Nozaki et al. (1995) |
| a-ch-rbcL-706-3’-MPN | R | 706-722 | AAAGGNCANATNNTAAA | Nelsen et al. (2011) |
| rbcL 712F | F | 712-731 | CATTAYTTAAATGCWACWGC | Verbruggen et al. (2009) |
| rbcL 791R | R | 769-788 | GGNAYACCNAAWTCTTTIGC | Verbruggen et al. (2009) |
| rbcL803 | R | 782-803 | TCGTGCATAATAATAGGTACAC | Nozaki et al. (1995) |
| rbcL 808F | F | 808-827 | TTAACTGGWGGTTKKACIGC | Verbruggen et al. (2009) |
| rbcL830 | R | 809-830 | TTAGCTGTGAAACCACCTGTTA | Nozaki et al. (1995) |
| rbcL 893R | R | 874-893 | TGCATKGCACGRTGIATRTG | Verbruggen et al. (2009) |
| rbcL 904R | R | 886-904 | CAATAACMGCRTGCATAGC | Verbruggen et al. (2009) |
| rbcL 9 | F | 922-938 | GGTATGCACTTCCGTGT | Zechman (2003) |
| rbcL 9R | R | 922-938 | ACACGGAAGTGCATACC | Zechman (2003) |
| a-ch-rbcL-991-3’-MPN | R | 991-1010 | CCTTCTARTTTACCWACAAC | Nelsen et al. (2011) |
| RT994 | R | 994-1017 | TCTATCTCCTTCTAATTTTCCTAC | Rindi et al. (2009) |
| RT1134 | R | 1141-1161 | CATGTGCCAAATGTGAATACC | Rindi et al. (2008) |
| rbcL1181 | R | 1160-1181 | AAGATTTCAACTAAAGCTGGCA | Nozaki et al. (1995) |
| R1220 | R | 1220-1244 | GGTGCATTACCCCATGGGTGTCCTA | Rindi et al. (2008) |
| rbcL 1391R | R | 1372-1391 | TCTTTCCAAACTTCACAAGC | Verbruggen et al. (2009) |
| rbcL Q | R | 1372-1395 | GATCTCCTTCCATACTTCACAAGC | Woolcott in Zechman (2003) |
| rbcL 1385R | R | 1385-1406 | AATTCAAATTTAATTTCTTTCC | Manhart (1994) |
| rbcL1421 | R | 1402-1421 | TTGTCAATAGTATCAAATTC | Nozaki et al. (1995) |
Manhart, J.R. 1994. Phylogenetic analysis of green plant rbcL sequences. Molecular Phylogenetics and Evolution 3: 114-127.
Nelsen, M.P., E. Rivas Plata, C.J. Andrew, R. Lücking & H.T. Lumbsch. 2011. Phylogenetic diversity of trentepohlialean algae associated with lichen-forming fungi. Journal of Phycology 47: 282-290.
Nozaki, H., M. Ito, R. Sano, H. Uchida, M.M. Watanabe, H. Takahashi & T. Kuroiwa. 1995. Phylogenetic relationships within the colonial Volvocales (Chlorophyta) inferred from rbcL gene sequence data. Journal of Phycology 31: 970-979.Rindi, F., M.D. Guiry & J.M. López-Bautista. 2008. Distribution, morphology and phylogeny of Klebsormidium (Klebsormidiales, Charophyceae) in urban environments in Europe. Journal of Phycology 44: 1529-1540.
Rindi, F., D.W. Lam & J.M. López-Bautista. 2009. Phylogenetic relationships and species circumscription in Trentepohlia and Printzina (Trentepohliales, Chlorophyta). Molecular Phylogenetics and Evolution 52: 329-339.
Verbruggen, H., M. Ashworth, S.T. LoDuca, C. Vlaeminck, E. Cocquyt, T. Sauvage, F.W. Zechman, D.S. Littler, M.M. Littler, F. Leliaert & O. DeClecrk. 2009. A multi-locus time-calibrated phylogeny of the siphonous green algae. Molecular Phylogenetics and Evolution 50: 642-653.
Zechman, F.W. 2003. Phylogeny of the Dasycladales (Chlorophyta, Ulvophyceae) based on analyses of rubisco large subunit (rbcL) gene sequences. Journal of Phycology 39: 819-827.
Algal Internal Transcribed Spacer (ITS):
| Primer | F/R | Locus | Position | Sequence | Reference |
| *AL1500af | F | 18S | 1458-1474 | GCGCGCTACACTGATGC | Helms et al. (2001) |
| *AL1500bf | F | 18S | 1470-1488 | GATGCATTCAACGAGCCTA | Helms et al. (2001) |
| *KL-ITS1A2 | F | 18S | 1648-1668 | CGATTGGGTGTGCTGGTGAAG | Lohtander et al. (2003) |
| *ITS1AKL | F | 18S | 1657-1676 | GTGCTGGTGAAGTGTTCGGA | Dahlkild et al. (2001) |
| *AL1729 | F | 18S | 1722-1745 | AACCCTCCCACYTAGAGGAGGGAG | Helms et al. (2001) |
| *AL1700f | F | 18S | 1728-1745 | CCCACCTAGAGGAAGGAG | Helms et al. (2001) |
| *a-nu-ssu-1752-5’ | F | 18S | 1733-1752 | CTAGAGGAAGGAGAAGTCGT | Nelsen & Gargas (2006) |
| ITS1 | F | 18S | 1762-1780 | TCCGTAGGTGAACCTGCGG | White et al. (1990) |
| *nr-SSU-1780-5’ Algal | F | 18S-ITS1 | 1775-4 | CTGCGGAAGGATCATTGATTC | Piercey-Normore & DePriest (2001) |
| *ITS1T | F | 18S-ITS1 | 1779-10 | GGAAGGATCATTGAATCTATCGT | Kroken & Taylor (2000) |
| *ITS6AKL | R | 28S | 7-24 | ATCTTGCCTGAGCTCAGG | Dahlkild et al. (2001) |
| ITS3 | F | 5.8S | 31-50 | GCATCGATGAAGAACGCAGC | White et al. (1990) |
| ITS3T | F | 5.8S | 33-53 | AACGATGAAGAACGCAGCGAA | Kroken & Taylor (2000) |
| ITS2 | R | 5.8S | 31-50 | GCTGCGTTCTTCATCGATGC | White et al. (1990) |
| ITS2T | R | 5.8S | 33-53 | TTCGCTGCGTTCTTCATCGTT | Kroken & Taylor (2000) |
| *nr-LSU-0012-3’ Algal | R | 28S | 19-37 | AGTTCAGCGGGTGGTCTTG | Piercey-Normore & DePriest (2001) |
| ITS4 | R | 28S | 41-60 | TCCTCCGCTTATTGATATGC | White et al. (1990) |
| LR1 | R | 28S | 57-73 | GGTTGGTTTCTTTTCCT | Vilgalys & Hester (1990) |
| *ITS4T | R | 28S | 84-102 | GGTTCGCTCGCCGCTACTA | Kroken & Taylor (2000) |
| *CHspeHLR1R | R | 28S | 136-158 | CACTAGACTACAATTCGCCAGCC | Hoshina et al. (2005) |
| *HLR3R | R | 28S | 264-282 | TCCCAAACAACCCGACTCT | Hoshina et al. (2005) |
Many of these primers have been used in combination with each other
to amplify the algal ITS directly from lichen thalli.
SSU positions relative to Chlamydomonas reinhardtii M32703
5.8S positions relative to Chlamydomonas reinhardtii U66954
LSU positions relative to Pseudochlorella pringhsheimii D17810
Dahlkild, Å, M. Källersjö, K. Lohtander & A. Tehler. 2001. Photobiont diversity in the Physciaceae (Lecanorales). Bryologist 104: 527-536.
Helms, G., T. Friedl, G. Rambold & H. Mayrhofer. 2001. Identification of photobionts from the lichen family Physciaceae using algal-specific ITS rDNA sequences. Lichenologist 33: 73-86.
Hoshina, R., Y, Kamako & N. Imamura. 2005. Genetic evidence of “American” and “European” type symbiotic algae of Paramecium bursaria Ehrenberg. Plant Biology 7: 525-532.
Kroken, S. & J.W. Taylor. 2000. Phylogenetic species, reproductive mode, and specificity of the green alga Trebouxia forming lichens with the fungal genus Letharia. Bryologist 103: 645-660.
Lohtander, K., I. Oksanen & J. Rikkinen. 2003. Genetic diversity of green algal and cyanobacterial photobionts in Nephroma(Peltigerales). Lichenologist 35: 325-339.
Nelsen, M.P. & A. Gargas. 2006. Actin type I introns offer potential for increasing phylogenetic resolution in Asterochloris (Chlorophyta: Trebouxiophyceae). Lichenologist 38: 435-440.
Piercey-Normore, M.D. & P.T. DePriest. 2001. Algal switching among lichen symbioses. American Journal of Botany 88: 1490-1498.
Vilgalys, R. & M. Hester. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
White, T.J., T. Bruns, S. Lee & J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 in PCR Protocols: A Guide to Methods and Applications (Innis, N., D. Gelfand, J. Sninsky & T. White, Eds.), Academic Press.
MATTHEW P NELSEN 